Insecticidal activity and bio-control effeet of Autogra pha californica multiplenucleopolyhedrovirus(AcMNPV)on larvae of Spodoptera frugiperda

May 14, 2024
Latest company case about Insecticidal activity and bio-control effeet of Autogra pha californica multiplenucleopolyhedrovirus(AcMNPV)on larvae of Spodoptera frugiperda
Abstract

Fall armyworm,Spodoptera frugiperda,is one of the most important pests on maize, Which invaded into China newly.In order to determine the control effect of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) on larvae of S.frugiperda, the insecticidal activity and biocontrol effect of AcMNPV on S.frugiperda were studied and analyzed by the methods of bioassay and field efficacy test.The results showed that the median lethal concentration (LC50)of AcMNPV acting on the 2nd instar larvae of S.Frugiperda was 2.9x 107 PIB/mL.The average control efficacy of 107 PIB/mL AcMNPV+Bt suspension(1500 mL/hm2) on S.frugiperda was 68.99% on the 10th day and 66.87% on the 15th day after administration.Finally,DNAMAN 6.0 software was used to identify the DNA homology of the dead insects,and the results showed that the polh,lef-8 and lef-9 gene sequences sequences of the dead insect and the S.Frugiperda were 100% identical.All the above results could further verify that AcMNPV may play a key role on controlling S.Frugiperda.It is suggested that 107 PIB/mL AcMNPV+Bt suspension (1500mL/hm2)should be applied at the peak of the occurrence of the young larvae of S.frugiperda,and after4:00-5:00 pm on sunny day to avoid the influence of high temperature and light,so that the virus preparation can play a better role and improve its control effect on S.frugiperda.

Keywords:

AcMNPV; Spodoptera frugiperda; Lepidopteranpest; larval; bio-pesticide; AcMNPV+Bt Suspension; insecticidal activity; green prevention and control

Spodoptera frugiperda is an omnivorous migratory pest that first entered China from Myanmar in 2019 and has rapidly spread to 1,518 districts in 26 provinces and municipalities in China, posing a serious threat to China's food security.Up to now, in the control strategy of Armyworm, the control of armyworm outbreak still depends on the heavy use of chemical pesticides. The overuse of chemical pesticides can easily cause pest resistance, re-rampant and environmental residue and pollution. A series of serious problems have seriously restricted the sustainable development of modern agriculture.Therefore, the use of biological control methods or biopesticide substitution. The use of pesticides to control Armyworm is becoming more and more important and has received increasing attention.

Autographa californica multiple nucleopolyhedrovirus AcMNPV is a multi-grain embedded nuclear polyhedrosis virus isolated from the larva of Argyria alfalfa.It can cross-infect more than 30 kinds of lepidopteran pests such as Beet moth, cabbage moth, Argyria argyra, and Calyptera teristoides,The mixed type with Bt and other insecticides and non-target pest viruses as synergists has obvious synergistic effect on many Noctuidae pests, and further broadens the insecticidal spectrum and improves the insecticidal effect. AcMNPV is a new biopesticide of insect virus developed by Wuhan Unioasis Biological Technology Co., LTD. It is a combination of Argyria alfalfa nuclear polyhedrosis virus and Bt potent virus synergist. With good insecticidal activity, A has been widely applied in vegetables, fruit trees, rice and other fields. In this paper, the insecticidal activity and biocontrol effect of Autographa californica mul-tiple nucleopolyhedrovirus(AcMNPV) against Spodoptera frugiperda were detected and evaluated by laboratory activity assay and field experiment, in order to provide data support for the wide application of nuclear polyhedrosis virus in the biological control of Spodoptera frugiperda in corn. It provides theoretical basis for the registration and application of the suspension agent of AcMNPV plus Bt in the control of Armyworm.

1. Materials and methods
1.1 Test viruses and biological agents

The virus tested was Autographa californica multiple nucleopolyhedrovirus (AcMNPV) On May 20, 2019, Spodoptera frugiperda was collected from the corn field in Xiantao City, Hubei Province, and the virus infection screening test was conducted in the laboratory of Wuhan Unioasis Biological Technology Co., LTD. (In which Autographa Californica multiplenucleopolyhedrovirus AcMNPV has high infectious activity against Spodoptera frugiperda),The larvae of Spodoptera frugiperda were raised to increase and propagate.The dead larvae infected with the virus were ground with water, filtered through 3 layers of gauze, and the filtrate was centrifuged at 600r/min and 300r/min.The microcount was 1.8 *1010 virulent polyhedra per mL(Polyhedralinclusionbody PIB), that is, to get a pure Technical grade of polyhedrosis virus(1.8 x 1010 PIB/mL), preserved in low temperature and set aside.

The biological agent tested was Autographa california nuclear polyhedrosis.Bacillus thuringiensis for short AcNPV.Bt(1.0 *107 PIB/mL). It is developed by Wuhan Unioasis Bilogical Technology Co., LTD and produced by its subsidiary Wuhan Chuqiang Biological Technology Co., LTD.

1.2 Test insects

The experimental insect was Spodoptera frugiperda. On July 20, 2019, the larvae of Spodoptera frugiperda were collected from the summer corn field in Banqiao village, Dachangzhen Town, Tongshan County, Hubei Province, and brought back to the laboratory of Plant Protection Soil and Fertilizer Research Institute of Hubei Academy of Agricultural Sciences.Fresh and tender corn leaves were fed single-head in disposable plastic petri dishes (diameter 8cm, height 3cm). The indoor feeding conditions of were :(25±1) ℃ and relative humidity 60%-70%, photoperiod is 16L:8D. After multiple generations of reproduction, fresh and sterilized egg blocks are retained for use.

1.3 Laboratory activity of Autographa californica multiple nucleopolyhedrovirus(AcMNPV) against spodoptera frugiperda

Six concentration gradients, 1.0 *109, 1.0 *108, 1.0 *107, 1.0 *106, 1.0 *105, 1.0 *104were designed in this experiment.First, the TC of AcNPV was diluted to 1.0 *109 PIB/mL, and then diluted 10 times to obtain other diluents with different concentrations.The experiment was treated with blank control.A total of 7 processes were performed, with each process repeated 3 times.

Leaf segment feeding method was adopted, that is, fresh maize young leaves (length 2cm * width 2cm) were first treated with virus suspension spray, then larvae were fed, and single head were fed in petri dishes. The feeding strips were: temperature (25±1)℃, phase-to-humidity (60% ~ 70%), photoperiod (16L:8D).After the toxic corn leaves are eaten, fresh non-toxic corn leaves should be added immediately.48 second instar larvae of Armyworm were treated repeatedly.Reference part 9{9-11} , Considering the changes of the proliferation of the virus in the cells and hosts of the moth family, the number of dead insects due to the virus and the total number of dead insects were investigated at 7 and 10 days after the infection, and the mortality rate was calculated and LC50 was calculated.

1.4 Field test on the control effect of 10 million AcMNPV.Bt suspensions on Armyworm larvae

The field efficacy test was conducted in the summer maize field of Xiaoyuan village, Chuangwang Town, Tongshan County, Hubei Province. The test plot is a total of 1500m, the soil type is calcic soil, the pH value is 6.8, the organic matter content is 13.9%, and the fertility is medium to high.Corn is planted all year round, and the corn variety is Xiyu No. 3. On July 13,2020, 45% compound fertilizer 750kg//hm will be applied as base fertilizer and sown. Since 2019, there has been a serious occurrence of Fall armyworm in this field.

A total of 10 million AcMNPV.BT suspensions (1500mL/ hm2) and 15% emamectin benzoate.Indocarb suspension (300mL/ hm2), commonly used insecticide and blank control were treated with 3 treatments. Each treatment was repeated 4 times, with a total of 12 experimental plots, each covering an area of 100m2

In the afternoon of August 26, 2020 (when the larvae of Spodoptera frugiperda occur frequently), spray the pesticide once in the evening. The Lebang brand 3WBJ-16DZ multi-function backpack electric spray is used, with the working pressure of 0.40~0.60 MPa, the orifice diameter of 1mm, and the flow rate of 60~85L/h. The day of pesticide application is sunny, with a temperature of 23-32 ℃. Conduct surveys on the 1st, 3rd, 5th, 7th, 10th, and 15th day after application. During the investigation, 10 random sampling points were taken from each plot, and 10 plants were continuously surveyed at each point, totaling 100 plants. The number of live insects, deaths, poisoning, and natural enemies on each corn plant were recorded. The relevant calculation formula is as follows;

Decrease rate of insect =(number of live insects before application - number of live insects after application)/number of live insects before application

Prevention and control effect=( Decrease rate of insect in treatment area- Decrease rate of insect in control area)/(100- Decrease rate of insect in control area)*100%

1.5 Molecular identification of ACMNPV

1) Test virus samples. Select the ACMNPV mother liquor for indoor activity determination (sample 1), biological preparation 10 million ACMNPV.Bt SC (sample 2), virus infected insect corpses after field efficacy testing (sample 3), and the second-generation larvae of armyworm infected with insect corpses collected in sample 3 (sample 4) as the test virus samples, to verify whether AcMNPV in the 10 million ACMNPV.Bt has bactericidal activity against fall armyworm larvae.

2) DNA extraction. Take 1.0 mL of AcMNPV sample, add 99.0 mL of distilled water, and oscillate thoroughly for 1 minute. Take 300μL suspension after oscillation, add 100μL alkaline cracking solution, water bath at 37 ℃ for 30 minutes. Add 200μL Tris·HCl buffer and centrifuge at 10000 r/min for 8 minutes. Take the supernatant into a centrifuge tube, add 5μL Protease K and 60 μ L SDS, water bath at 65 ℃ for 2 hours, remove and cool to room temperature. Add 650μL Mix L Tris saturated phenol well, centrifuge at 10000 r/min for 5 minutes, and take the supernatant into a new centrifuge tube. Add 650μL mixed liquid of phenol and chloroform (volume ratio 1:1) mixture, centrifuge at 10000 r/min for 5 minutes, and then take the supernatant into a new centrifuge tube. Add 650μL mixed liquid of chloroform and isoamyl alcohol (volume ratio 24:1), centrifuge at 10000 r/min for 5 minutes, and finally take the supernatant into a new centrifuge tube. Measure the DNA concentration using a spectrophotometer.

3) PCR amplification. Using T3 super mix standard system: Sample DNA 2 μ L. 0.5μL primers for before and after, T3 super mix 18μL and ddH₂O7μL. The PCR amplification condition is 95 ℃. After 3 minutes of pre denaturation, the following cycles are performed: 98 ℃ for 15 seconds, 52 ℃ for 20 seconds, 72 ℃ for 20 seconds, and finally 72 ℃ for 5 minutes, totally 42 times cycle.

4) DNA agarose gel electrophoresis. Take PCR amplification product 2μL and 5 kb DNA Marker and put in agarose gel, and electrophoretic at 180 V for 20 min. After electrophoresis, observe the PCR products in the gel imaging system.

Polh upstream primer:

AGGGTTTCCCAGTCACGGGCTGAG-GATCCTTT

Polh downstream primer:

GAGCGGATAATTTCACACTGGTGTGTG-CAAACTCCTT

Lef-8 upstream primer:

AGGGTTTCCCAGTCCACGCACGGGAAAT-GAC

Lef-8 downstream primers:

GAGCGGATAATTTCACATTGTACGGATCTTTCGGC

Lef-9 upstream primers

AGGGTTTCCCAGTCACGAAACGGGTACGCGG

Lef-9 downstream primers:

GAGCGGATAATTTCACATTGTCACCGTCAGTC

Finally, apply DNAMAN6.0 software to compare the measured polh, lef-8, and lef-9 sequences.

1.6 Data analysis and processing

The experimental data was processed using IBM SPSS 22.0 data statistical analysis software.

In the virus insecticidal activity determination experiment, the number of dead and live insects treated with each concentration is counted, and the mortality rate and adjusted percentage dead are calculated, and converted into probability values. The concentration of each treatment is converted into lg values. The virulence regression equation (slope ± SE) is calculated through working probability values and weights, and LC50 Value and its 95% confidence limit, and finally perform chi-square test(2). In the field control effect experiment, the number of live insects in each treatment was counted, the rate of pest reduction was calculate. The control effect was calculated using Microsoft Excel editing formula. Duncan's method was used for analysis, and one-way ANOVA was used to compare the significant differences between the treatments,

The charts in the text were all created using Microsoft Excel software.

2. Results and Analysis
2.1 Insecticidal activity of AcMNPV against Spodoptera frugiperda larvae

The results of indoor activity testing (Table 1) show that after 7 days of treatment, the LC50 of AcMNPV acts on 2nd instar larvae of the Spodoptera frugiperda is 4.1x107PIB/mL, and the LC90 is 1.05 x108PIB/mL. After 10 days of treatment, the LC50 of AcMNPV acts on 2nd instar larvae is 2.9x107PIB/mL, and the LC90 is 7.8x107PIB/mL. The LC50 and LC90 of AcMNPV acts on the 2nd instar larvae of fall armyworm after 7 days of treatment were both higher than 10 days, indicating that the AcMNPV exhibited good insecticidal activity against Spodoptera frugiperda larvae at 7 days.

latest company case about Insecticidal activity and bio-control effeet of Autogra pha californica multiplenucleopolyhedrovirus(AcMNPV)on larvae of Spodoptera frugiperda  0

2.2 Field control effect of AcMNPV. Bt act on Spodoptera frugiperda larvae

The results of field efficacy trials showed that 10 million AcMNPV. Bt SC (1500 mL/hm2) had a relatively slow effect on the larvae of spodoptera frugiperda. The average control effect on the 1st, 3rd, and 5th day after spraying was 11.57%, 16.23%, and 15.56%, respectively. The average control effect on the 7th day after spraying was only 21.88%. However, on the 10th day after spraying, the insect control effect suddenly increased to 68.99%, and the average control effect on the 15th day after spraying was also 66.87%. However, compared to chemical agents Emamectin Benzoate+ Indoxair Conditioningarb 15% (300mL/hm2), it had a good killing effect on the larvae of spodoptera frugiperda, which can quickly reduce the number of insect population. The average control effect on the 1st, 3rd, 5th, and 7th day after medication was 91.39%, 92.66%, 90.71%, and 87.19%, respectively. However, the average control effect on the 10th day began to decrease, only to 67.63%, and the average control effect on the 15th day had decreased to 51.60%. See Table 2 for details.

At the same time, we also found that the decrease rate of insect in the control area was negative on the 1st, 3rd, and 5th day after treatment, indicating an increase in the number of insects. On the 7th day after treatment, it began to become positive (insect population began to decrease). The average decrease rate of insect on the 10th and 15th days were 38.25% and 47.00% respectively, which is highly likely related to the fact that some of the larvae of spodoptera frugiperda began to pupate in the soil and generations overlapped after 10-15 days.

In summary, it can be seen that the 10 million AcMNPV. Bt SC (1500 mL/hm2) has a certain control effect on spodoptera frugiperda, but its effect is slow, and its efficacy is about 10-15 days after application.

latest company case about Insecticidal activity and bio-control effeet of Autogra pha californica multiplenucleopolyhedrovirus(AcMNPV)on larvae of Spodoptera frugiperda  1

2.3 Effects of AcMNPV. Bt on natural enemies

During field experiments, the effects of 10 million AcMNPV. Bt suspension on natural enemies of pests on corn, such as spiders, ladybugs, and beetles, were also investigated. The results showed that 10 million AcMNPV. Bt suspension did not have significant damage to natural enemies such as spiders, ladybugs, and beetles, with an average of 13.4 natural enemies per 100 plants. However, the chemical agents Emamectin Benzoate+ Indoxair Conditioningarb 15% suspension had a significant toxic effect on natural enemies such as spiders, ladybugs, and beetles. On the first day after treatment, the average number of natural enemies on 100 plants of corn was only 3.1, and on the third day after treatment, only 5.2 natural enemies of various types (Figure 1) were found. It can be seen that the 10 million AcMNPV. Bt suspension has a good protective effect on natural enemies of pests, while Emamectin Benzoate+ Indoxair Conditioningarb 15% suspension causes relatively greater damage to natural enemies.

latest company case about Insecticidal activity and bio-control effeet of Autogra pha californica multiplenucleopolyhedrovirus(AcMNPV)on larvae of Spodoptera frugiperda  2

2.4 Molecular identification of AcMNPV

The PCR amplification results of different test samples showed that the amplification fragments of polh, lef-8, and lef-9 of samples 1, 2, 3, and 4 were consistent and correct in size. The PCR products of polh, lef-8, and lef-9 genes were 0.54, 0.716, and 0.29 kb, respectively (Figure 2), which proves that AcMNPV has insecticidal activity against the larvae of spodoptera frugiperda.

Finally, DNAMAN 6.0 software was used to perform sequence alignment on the amplified fragments of polh, lef-8, and le.f-9 in samples 1, 2, 3, and 4 (Figure 3). The results showed that the similarity between the amplified sequences of polh, lef-8, and lef-9 in samples 1, 2, 3, and 4 was 100%, indicating that samples 1, 2, 3, and 4 all originate from the same virus AcMNPV.

latest company case about Insecticidal activity and bio-control effeet of Autogra pha californica multiplenucleopolyhedrovirus(AcMNPV)on larvae of Spodoptera frugiperda  3

latest company case about Insecticidal activity and bio-control effeet of Autogra pha californica multiplenucleopolyhedrovirus(AcMNPV)on larvae of Spodoptera frugiperda  4

3. Discussion

AcMNPV is an insect rod-shaped virus that infects the body of insects through feeding. The virus proliferates and spreads throughout the insect body, gradually infecting the entire body and ultimately leading to death. The results of this study indicate that the AcMNPV has good biological activity against the larvae of Spodoptera frugiperda. Its LC on the 7th and 10th days were 4.1x107and 2.9x107PIB/m, respectively, and it showed good control effects in the field. The mixed suspension of 10 million AcMNPV.Bt (1500 mL/hm2) had good average control effects on the 10th and 15th days after treatment, reaching 68.99% and 66.87% respectively, and was safe for natural enemies. Therefore, the research and development speed should be accelerated so that AcMNPV can play a greater role in the biological control of Spodoptera frugiperda. The 10 million AcMNPV.Bt suspension produced by Wuhan Chuqiang Biotechnology Co., Ltd. is a compound of AcMNPV and the biopesticide Bacillus thuringiensis (Bt), which can significantly improve the insecticidal activity of the virus. Because Bt is a broad-spectrum insecticide with good microbial insecticidal activity, when AcMNPV is combined with Bt, its toxicity should be significantly improved compared to a single formulation. This not only expands the insecticidal range of Bt, but also enhances its toxicity, achieving the goal of using a single formulation to control multiple pests. This is also the reason why the suspension of 10 million AcMNPV.Bt can be widely promoted in vegetables, fruit trees, and rice. Therefore, 10 million AcMNPV.Bt can be promoted as a green control agent for the Spodoptera frugiperda in maize

In this study, when conducting field efficacy tests, in the case of rapid decline in the insect population in the control area (the decrease rate of insect on the 15th day reached 47.00%),the average control effect of the 10 million AcMNPV.Bt suspension (1500mL/hm2) on the 15th day after treatment was 66.87%, showing a rapid upward trend. While the average control effect of the chemical pesticide 15% methoxazole · indefencarb SC (300 mL/hm2) on the 15th day after treatment decreased to 51.60%. Although it can be seen that the 10 million AcMNPV.Bt suspension (1500 mL/hm2) has a certain control effect on Spodoptera frugiperda on the 10th to 15th day, considering the slow effectiveness of biological pesticides and the short lifespan and overlapping generations of Spodoptera frugiperda larvae, it is recommended to increase the number of investigations and extend the investigation time when conducting field efficacy trials of biological pesticides (especially viral preparations), which may achieve more ideal experimental results. This is also a limitation of this study. In summary, compared with biological agents, chemical agents have a relatively higher killing effect on pests and take effect quickly. They can be used as an emergency prevention and control measure during pest outbreaks. When pests harm occur relatively lightly, biological pesticides can replace chemical pesticides as one of the green prevention and control measures, thereby reducing environmental pollution and achieving the effect of protecting agricultural ecology.

In addition, the Polh (polyhedrin) gene used in this study is a type of polyhedral protein promoter, it and P10 are the most commonly used promoter in the baculovirus expression vector system (BEVS), both of which are highly expressed in the late stage of viral infection[13]. However, the activity of the p10 promoter is lower than that of the polh promoter, so the polh promoter is often used for the expression of exogenous proteins. The gene lef-8 can encode the largest subunit of the virus's own RNA polymerase, and is a type of late expression factor [14]. lef-9 is a type of late expression factor that co encodes the protein complex subunit with lef-4, lef-8, and p47 in baculoviruses. Research has found that viruses lacking the lef-9 gene cannot generate virus particles with infectious activity, while viruses with the lef-9 gene can restore the virus's infectious activity by restoring it. Therefore, the lef-9 gene is an essential gene for baculovirus to form BV (Budded Virus) with infectious activity [15]. It can be seen that the lef-8 and lef-9 genes have high conservatism in different types of nuclear polyhedrosis viruses, so the lef-8 and lef-9 genes can be used as a basis for identifying virus types. Therefore, this study used polh, lef-8, and lef-9 as the detection objects, and through gene sequence alignment, the homology was high, all reaching 100%. The rapid molecular detection method once again verified that AcMNPV has good insecticidal activity against Spodoptera frugiperda, which is suitable for further promotion and application in the prevention and control of Spodoptera frugiperda.

Since 2019, the Spodoptera frugiperda has invaded China and become an important pest of corn. It has formed a settled population in some areas of southern and southwestern China, causing huge losses to China's corn industry and seriously threatening China's food security [16]. Faced with the current severe prevention and control situation of Spodoptera frugiperda in China, it is urgent to accelerate the screening and development of efficient pesticides for Spodoptera frugiperda prevention and control[17]. Although viral insecticides have limited their widespread application due to their slow rate of action and narrow insecticidal spectrum, in the context of increasing attention to ecology and environmental protection, baculovirus insecticide are expected to be increasingly widely used in agricultural production due to their significant advantages over traditional pesticides. Due to the susceptibility of insect virus preparations to external conditions such as high temperature, sunlight, rain, and the age of pests[18]. Therefore, it is recommended to apply pesticides during the peak period of the occurrence of pests larvae. It is best to use it after 4:00-5:00 pm on sunny days to avoid the impact of adverse environmental conditions such as high temperature and light, so that the virus formulation can better play its role and improve the control effect on pests.